Gunwitch is a member of the mASF forum. Acronyms used in this article can be looked up on the acronyms page. To get involved in discussions like this, you can join the mASF discussion forum at fastseduction.com/discussion.
Original discussion thread: http://fastseduction.com/discussion/fs?action=9&boardid=2&read=91652&fid=173
Ock and epitome were doing some very interesting "research" on this with photos of previous exs and such.
I posted a thread previously about that discovery channel thing that was talking about science of stuff from my audio course materials, I think ock had found a link to it.
Figured I would talk it here also...
There was a documentary called "the science of sexual attraction" or such that came out just weeks ago that explained it better than I can science wise.
I however knew about it before it hit mainstream science or "pop psychology", cause I steal my material from fuckin text books, not other gurus or books from the 70s.
But the basis isn't all the facial symetry shit, that is old hat.
It has first to do with how a zygote splits asymetrical in development based on gatc in dna in facial structure formation.
Second our visual development tends to have a built in biological preference, this is the shit those outside the biological psychology field are missing in attraction, loosely based on termination codons, or stop codons, I forget the specific term.
Which as an example looks like:
No I ain't god, no I aint a genetics expert, no I ain't even a biological psychologist lol. I pasted that though to explain the next part.
That yes socially programmed signals come in to play, preference for certain styles of dress, or height, her bodyfat level in some cultures, or even her amount of makeup she wears.
But when the codon (as in caps TAG) is reversed in the visual development center a preference for certain features facially and body composition wise will come in to play.
That is my best understanding of it anyhow at the science level. I never studied this shit cause it was fun, but for general game ideas to work.
You don't even need the science for it, you can go in field and approach based on facial attractiveness exlusively and will almost always get better reactions.
Go through your scrapbook of old girlfriends and see similar features amongst them.
Watch how every fuckin new girlfriend half your friends bring around look similar to their last one.
Yeah one might be 6' white blonde and decked out in porn chick look, and another a plain 5'5'' brunette who never wore makeup who was black, but still the prominent facial features are there.
Again this is the Cruz vs Tomei "no way dude she is a 7" "dude she is obviously a 10!" debates you get with guys.
Simply put "beauty is in the eye of the beholder" is very often also reversed, in that barring social extremes turning off your target, the most facially attractive (and/or similar structured to women you have fucked before etc) women will tend to reciprocate attention back much easier.
This is without some placebo or "internal belief" as you can observe it in guys with no concious perception of pick up or game. And when you have dealt with women enough, you can also tell what you are projecting outwardly from "inner game»" or not, and what is their genuine physical interest in you from the approach.
Suffice to say, you see "ass soup" spice girl effect shit, 5 chicks all decked out glamorous, big hair, heavy makeup, fancy clothes, high heels.
All equally "cunted out" for the club. You have to approach one and pick her up to save your life...
Your target should be the one you facially find the hottest.
For me it would have been scary spice, for another one of the others.
Way more odds of reciprocation. Again ain't a scientist here, but I would say this skill of selection, and going against the idea of "going ugly cause they are easier" improves ones game or approach to lay ratio by probably 10-20%.
Oddly it can happen naturally also for a guy as he gets more confidence in his pick up skills and starts approaching HIS 10s, thinking they are everyones 10s.
Shit like that occurs also. Way outside (and within) the scope of the science of the "method" of selecting targets itself.
Was some guys asking me about my system of "not going ugly" but in fact going the opposite and selecting targets off genetic basis who are more "your 10".
tcggccagatgccatctttggtgaaaccatggtagaagttggagcaccat
tctccttgaaaggacttatgggtaatgttatatgttctcctgcctactgg
aagccaagcacttttggtggagaagtgggttttcaaatcatcaacactgc
ctcaattcagtctctcatctgcaataacgtgaagggctgtccctttactt
cattcagtgttccagatccagagctcattaaaacagtcaccatcaatgca
agttcttcccgctccggactagatgatatcaatcccacagtactactaaa
agaacgttcgactgaactgTAGaagtctaatgatcatatttatttattta
tatgaaccatgtctattaatttaattatttaataatatttatattaaact
ccttatgttacttaacatcttctgtaacagaagtcagtactcctgttgcg
gagaaaggagtcatacttgtgaagacttttatgtcactactctaaagatt
ttgctgttgctgttaagtttggaaaacagtttttattctgttttataaac
(Code not real, had to snip for message length.)
